My Calculator

Oligonucleotide Melting Temperature (Tm) Calculator

Estimate the melting temperature of a DNA/RNA oligonucleotide from its sequence using the Wallace rule, the %GC method, and full nearest-neighbor thermodynamics (SantaLucia 1998), with a salt-corrected result and complete step-by-step working.

Oligo Tm

Paste a primer/probe sequence and set your reaction conditions.

Result

Melting temperature (nearest-neighbor)

62°C

SantaLucia (1998) unified nearest-neighbor parameters, salt-corrected.

len

27 nt

Length

GC

48.1%

GC content

2+4

80 °C

Wallace rule Tm

%GC

68.3 °C

%GC method Tm

Reading this result: Nearest-neighbor thermodynamics is the most reliable of the three methods shown for a 27 nt oligo. The Wallace rule (80 °C) is only a rough guide at this length; the %GC method (68.3 °C) is a reasonable middle-ground estimate.

Step-by-Step: Nearest-Neighbor Tm Calculation

Here's exactly how this answer was calculated, one step at a time.

Given: Sequence: ATGCGTACCGGTAACCTGAAGCTGATT (27 nt)

  1. Step 1: Clean and read the sequence

    Whitespace, numbers, and FASTA headers are stripped; U is treated as T.

    ATGCGTACCGGTAACCTGAAGCTGATT (27 nt, 48.1% GC)
  2. Step 2: Sum nearest-neighbor stacking terms (SantaLucia 1998)

    Summed across all 26 dinucleotide steps in the sequence, plus helix-initiation terms for the two terminal base pairs.

    deltaH (stacking + init) = -211.6 kcal/mol, deltaS (stacking + init) = -569.8 cal/(mol*K)
  3. Step 3: Apply the salt correction to deltaS

    Using [Na+] = 50 mM = 5.00e-2 M.

    deltaS(corrected) = -569.8 + 0.368 x 26 x ln(5.00e-2) = -598.46 cal/(mol*K)
  4. Step 4: Solve the Tm equation

    R = 1.987 cal/(mol*K); Ct = total strand concentration = 250 nM = 2.50e-7 M; divisor is 4 (two different strands at equal concentration).

    Tm (K) = deltaH x 1000 / (deltaS(corrected) + R x ln(Ct/4)) = 335.12 K
  5. Step 5: Convert to Celsius

    Tm = 335.12 - 273.15 = 61.97 °C

Melting temperature (Tm):

61.97 °C

Oligonucleotide Melting Temperature Calculator: Estimate Primer and Probe Tm

This free oligonucleotide melting temperature (Tm) calculator is built for anyone designing PCR primers, hybridization probes, or other short DNA/RNA oligos who needs to know the temperature at which a duplex is 50% dissociated into single strands. Tm is one of the most important numbers in primer design — set an annealing temperature too far from it and a PCR reaction can fail to amplify, or amplify the wrong product.

Three estimation methods are calculated side by side: the quick Wallace '2+4' rule, the salt-adjusted %GC method, and full nearest-neighbor (NN) thermodynamics using the SantaLucia (1998) unified parameter set — the same underlying approach used by widely used primer-design tools. Every result includes a complete step-by-step written solution showing exactly how the nearest-neighbor value was built up from the sequence.

What Is Melting Temperature (Tm)?

The melting temperature of a nucleic acid duplex is the temperature at which exactly half of the DNA (or RNA) strands are in the double-helix form and half have separated into single strands, for a given set of salt and strand-concentration conditions. Below Tm, the duplex is mostly intact; above it, mostly dissociated. Because a real DNA duplex 'melts' gradually rather than all at once, Tm is really the midpoint of that transition, not a hard on/off switch.

Tm depends on the exact base sequence (not just the overall base composition), the concentration of monovalent cations like Na+ or K+ in the buffer (which stabilize the duplex by shielding the phosphate backbone's negative charge), and the concentration of the oligo itself. Longer sequences and a higher GC content both raise Tm, since G-C base pairs form three hydrogen bonds versus two for A-T, and are more thermodynamically stable.

The Three Methods, Explained

Wallace '2+4' rule: Tm = 2 x (A+T) + 4 x (G+C). This decades-old rule of thumb simply counts bases and ignores sequence order, salt, and concentration entirely. It's fast, but it's only a reasonable approximation for very short oligos, roughly under 14 nucleotides — beyond that it increasingly overestimates the true Tm.

%GC method: Tm = 100.5 + 41 x (GC fraction) - 820/length + 16.6 x log10([Na+]). This salt-adjusted formula extends usefully from about 14 to 70 nucleotides and is a common middle-ground choice when a quick estimate is needed but sequence order still doesn't matter much at that length.

Nearest-neighbor (NN) thermodynamics: the most rigorous method, and the one used by this calculator's headline result. Instead of just counting bases, it sums the actual thermodynamic stacking energy (deltaH, enthalpy) and entropy (deltaS) contributed by every adjacent base-pair step in the sequence, using values measured experimentally for all 10 unique dinucleotide steps (SantaLucia, 1998). It then adds helix-initiation terms for the two ends, applies a salt correction to the entropy term, and solves directly for the temperature at which the duplex's free energy of formation is zero — which is exactly the definition of Tm.

The Nearest-Neighbor Tm Formula

Tm (in Kelvin) = 1000 x deltaH / (deltaS(corrected) + R x ln(Ct / x)), then convert to Celsius by subtracting 273.15. Here deltaH (kcal/mol) and deltaS (cal/mol*K) are summed across every nearest-neighbor dinucleotide step in the sequence plus the two terminal initiation terms, R = 1.987 cal/(mol*K) is the gas constant, Ct is the total oligo strand concentration in mol/L, and x is 4 for two different strands present at equal concentration (the usual primer-and-target case) or 1 for a self-complementary, palindromic duplex.

The salt correction applied here is deltaS(corrected) = deltaS + 0.368 x N x ln([Na+]), where N is the number of nearest-neighbor steps (sequence length minus one) and [Na+] is the monovalent cation concentration in mol/L. Raising the salt concentration increases deltaS(corrected) toward zero, which raises the predicted Tm — physically, more monovalent cations in solution better shield the negatively charged phosphate backbone, stabilizing the duplex.

Choosing Salt and Oligo Concentration Inputs

Standard PCR buffers commonly run around 50 mM monovalent salt (Na+ or the K+ equivalent), which is why 50 mM is the default here — but check your specific protocol, since some buffers run considerably higher or lower. The oligo (primer) strand concentration is typically in the tens to hundreds of nanomolar range for a standard PCR reaction; 250 nM is a common default primer concentration, but again, use your actual reaction concentration for the most accurate Tm.

The self-complementary checkbox matters only for oligos designed to fold back and pair with themselves (palindromic sequences, common in some hairpin probes and adapters) — for an ordinary primer binding to a separate template strand, leave it unchecked.

Common Mistakes When Estimating Oligo Tm

The most common mistake is using the Wallace '2+4' rule on a primer longer than about 14-18 nucleotides — since it ignores sequence order entirely, it can overestimate Tm noticeably for longer, real-world primers, potentially leading to an annealing temperature set too high for the reaction to work efficiently.

A second common mistake is forgetting that Tm is sensitive to salt concentration and using a generic default value instead of the buffer actually being used — a 10x difference in monovalent salt concentration can shift a nearest-neighbor Tm estimate by several degrees Celsius.

A third mistake is comparing Tm values calculated by two different tools or methods and assuming a real discrepancy in the primer itself — different tools sometimes use slightly different nearest-neighbor parameter sets, salt-correction formulas, or default concentrations, so a few tenths to a degree or two of difference between tools is normal and expected, not a sign of an error.

Real-World Uses of Oligo Tm

PCR and qPCR primer design lean on Tm heavily: a well-designed primer pair usually has closely matched Tm values (often within a couple of degrees of each other) so both primers anneal efficiently at the same cycling temperature, and the actual PCR annealing temperature is typically set a few degrees below the calculated primer Tm.

Hybridization probe design (for techniques like FISH, Southern/Northern blotting, and microarray probes) uses Tm to choose wash and hybridization temperatures stringent enough to reject mismatched or off-target binding while still allowing the correct, fully complementary duplex to remain stable. Molecular cloning and site-directed mutagenesis primer design also routinely checks Tm to make sure the primers used will actually anneal under the chosen reaction conditions.

Oligo Tm Calculator: Quick Reference Summary

Wallace rule: Tm = 2(A+T) + 4(G+C) — quick, but reliable only under ~14 nt. %GC method: Tm = 100.5 + 41 x GC fraction - 820/length + 16.6 x log10([Na+]) — a reasonable estimate from ~14 to 70 nt. Nearest-neighbor: Tm(K) = 1000 x deltaH / (deltaS(corrected) + R x ln(Ct/x)) — the most accurate method across the typical primer-length range, and the headline result shown by this calculator.

This calculator is intended to support learning, primer design planning, and everyday molecular biology questions. Different published nearest-neighbor parameter sets and salt-correction models exist and give slightly different results, so for critical experimental design, cross-check against your lab's standard tool and validate empirically where it matters.

Frequently Asked Questions

What is oligonucleotide melting temperature (Tm)?

Tm is the temperature at which half of a DNA or RNA duplex has dissociated into single strands, under a given set of salt and strand-concentration conditions. It's a key number in designing PCR primers and hybridization probes.

Which Tm method is most accurate?

Nearest-neighbor (NN) thermodynamics, which this calculator's headline result uses. It accounts for the actual sequence order, salt concentration, and oligo concentration, unlike the simpler Wallace rule and %GC method, which are faster but less precise.

What is the Wallace rule for Tm?

Tm = 2 x (A+T) + 4 x (G+C), counting bases only. It's a fast rule of thumb that's reasonably accurate only for short oligos, roughly under 14 nucleotides.

Why does salt concentration affect Tm?

Monovalent cations like Na+ shield the negative charge on the DNA backbone's phosphate groups, reducing the electrostatic repulsion between the two strands. More salt stabilizes the duplex and raises Tm; less salt lowers it.

What Na+ and primer concentration should I use?

Use the actual values from your reaction — many standard PCR buffers run around 50 mM monovalent salt, and primer concentrations are commonly in the tens to hundreds of nanomolar range, but always check your specific protocol for the exact figures.

Why do two Tm calculators give me slightly different answers?

Different tools sometimes use different nearest-neighbor parameter sets, salt-correction formulas, or default salt/concentration values. A difference of a degree or two between reputable tools is normal, not necessarily an error.

When should I use the self-complementary option?

Only for a palindromic oligo designed to fold back and pair with itself, such as some hairpin probes or adapter sequences. For an ordinary primer binding a separate template strand, leave it unchecked.

Does GC content alone determine Tm?

It's a strong influence — since G-C pairs form three hydrogen bonds versus two for A-T — but the exact order of bases also matters, which is why the nearest-neighbor method, which accounts for sequence order, is more accurate than methods based on GC content alone.